Skip to main content
Search
Main content

Brain pericyte lineage tracing

Tool (i.e. cellular manipulation, labelling, tracking)

Overview

Species

Mouse

Strain common name

Atp13a5 tdT

Full nomenclature

Atp13a5-2A-CreERT2-IRES-tdTomato

Genetic background

C57BL/6J

Description of model, including genes and any mutation(s):

Possibility to acutely ablate brain pericyte when crossed with iDTR mice - Donor DNA templates encoding self-cleaving 2A peptide, CreERT2, internal ribosome entry site, tdTomato, and flp recombinase (2A-CreERT2-Frt-IRES-tdTomato-Frt) were synthesized. These sequences were flanked by 1184bp sequences and 1237bp sequences homologous to the last exon and 3’ UTR region of Atp13a5 gene. In addition, the IRES-tdTomato sequence is further flanked by two flp recombinase target (frt) sites. Next, these donor vector containing the 2A-CreERT2-Frt-IRES-tdTomato-Frt cassette, and gRNA (TTTTGGACTAGACTGTAACCAGG) were co-injected into fertilized C57BL/6N mouse eggs to generate targeted conditional knock-in offspring.

Original publication of model

DOI: 10.1101/2021.07.09.451694

Breeding scheme

Homo x Homo

Type of model

Tool (i.e. cellular manipulation, labelling, tracking)
Availability
Study details